ID: 1017502099_1017502105

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1017502099 1017502105
Species Human (GRCh38) Human (GRCh38)
Location 6:155035035-155035057 6:155035071-155035093
Sequence CCTATATGGGTCCACGAAGCTTT GAAAAGGTAGAAATATGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28} {0: 1, 1: 0, 2: 3, 3: 46, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!