ID: 1017515235_1017515242

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1017515235 1017515242
Species Human (GRCh38) Human (GRCh38)
Location 6:155150458-155150480 6:155150501-155150523
Sequence CCAGGCTGGAAGGGTGTTGGGCG AGTGACTGAGTGGTGGCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 333} {0: 1, 1: 0, 2: 1, 3: 20, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!