ID: 1017883831_1017883836

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1017883831 1017883836
Species Human (GRCh38) Human (GRCh38)
Location 6:158582149-158582171 6:158582194-158582216
Sequence CCTTTGCATTGCTTTATTTTCTT ATTTGAGGAGGTGCCGCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 21, 3: 236, 4: 1894} {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!