ID: 1018016897_1018016904

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1018016897 1018016904
Species Human (GRCh38) Human (GRCh38)
Location 6:159720762-159720784 6:159720810-159720832
Sequence CCCACTATTACTGATACTAAATT ACCAGATGGCTCCACTATACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!