ID: 1018016898_1018016904

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1018016898 1018016904
Species Human (GRCh38) Human (GRCh38)
Location 6:159720763-159720785 6:159720810-159720832
Sequence CCACTATTACTGATACTAAATTT ACCAGATGGCTCCACTATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 299} {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!