ID: 1018088160_1018088165

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1018088160 1018088165
Species Human (GRCh38) Human (GRCh38)
Location 6:160322898-160322920 6:160322928-160322950
Sequence CCACCCCTCTGCTGGCGGCTTTC CTGTTGCCCTGGTCCCTCCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!