ID: 1018250530_1018250533

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1018250530 1018250533
Species Human (GRCh38) Human (GRCh38)
Location 6:161865446-161865468 6:161865466-161865488
Sequence CCAACTATGAAAGTCCTAGATGG TGGCATCTTTTTACAACAGAAGG
Strand - +
Off-target summary {0: 1, 1: 25, 2: 43, 3: 50, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!