ID: 1018324283_1018324289

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1018324283 1018324289
Species Human (GRCh38) Human (GRCh38)
Location 6:162648463-162648485 6:162648494-162648516
Sequence CCTCCGCCCGCCGGGTTCAAGTG GCCTCAGCCTCCCGAGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 104, 2: 5664, 3: 38503, 4: 104413} {0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!