ID: 1018334791_1018334797

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1018334791 1018334797
Species Human (GRCh38) Human (GRCh38)
Location 6:162775135-162775157 6:162775167-162775189
Sequence CCTTCCACCATGTGGGGACCCAG ATAACATATGAACCAGAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 18, 2: 330, 3: 880, 4: 1991} {0: 1, 1: 0, 2: 2, 3: 36, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!