ID: 1018420317_1018420323

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1018420317 1018420323
Species Human (GRCh38) Human (GRCh38)
Location 6:163635184-163635206 6:163635212-163635234
Sequence CCAAGGAGTGTGTGCCTCCCTGA GAAGATTTCCCTGGAACTGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!