ID: 1018420317_1018420330

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1018420317 1018420330
Species Human (GRCh38) Human (GRCh38)
Location 6:163635184-163635206 6:163635226-163635248
Sequence CCAAGGAGTGTGTGCCTCCCTGA AACTGTTGGCTGTCGGGGGTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!