ID: 1018527493_1018527499

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1018527493 1018527499
Species Human (GRCh38) Human (GRCh38)
Location 6:164729086-164729108 6:164729104-164729126
Sequence CCTTCACTGAGGCACTGCCTAGT CTAGTGGAGCTGTGGGAAGAGGG
Strand - +
Off-target summary No data {0: 42, 1: 1749, 2: 2157, 3: 1421, 4: 1020}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!