ID: 1018777090_1018777096

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1018777090 1018777096
Species Human (GRCh38) Human (GRCh38)
Location 6:167027581-167027603 6:167027610-167027632
Sequence CCTTCCCTCTTCTGGAGAGACAT TAGTGCAAAGAACTTGGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 272} {0: 1, 1: 0, 2: 1, 3: 15, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!