ID: 1018799552_1018799557

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1018799552 1018799557
Species Human (GRCh38) Human (GRCh38)
Location 6:167211287-167211309 6:167211335-167211357
Sequence CCAGGGATGTTCTATTCCCATCC AAAAAAAAAAAAAAAAAAAAAGG
Strand - +
Off-target summary No data {0: 22235, 1: 21563, 2: 42018, 3: 80771, 4: 155626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!