ID: 1018855319_1018855329

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1018855319 1018855329
Species Human (GRCh38) Human (GRCh38)
Location 6:167670406-167670428 6:167670433-167670455
Sequence CCCTGGAGGGACCTCCCCCACAT CCCTGCTCCAGAAGCATGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144} {0: 1, 1: 0, 2: 2, 3: 22, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!