ID: 1018855321_1018855335

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1018855321 1018855335
Species Human (GRCh38) Human (GRCh38)
Location 6:167670417-167670439 6:167670464-167670486
Sequence CCTCCCCCACATGAAACCCTGCT TGCATTCCCCAGGGAGAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 224} {0: 1, 1: 0, 2: 1, 3: 23, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!