ID: 1018883065_1018883074

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1018883065 1018883074
Species Human (GRCh38) Human (GRCh38)
Location 6:167904454-167904476 6:167904507-167904529
Sequence CCTGCCTCGGCTTCCCAAAATGC GCCCCGATTCATATCTCTAAAGG
Strand - +
Off-target summary {0: 141, 1: 6338, 2: 107553, 3: 243972, 4: 244222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!