ID: 1018883066_1018883074 |
View in Genome Browser |
Spacer: 26 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1018883066 | 1018883074 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:167904458-167904480 | 6:167904507-167904529 |
| Sequence | CCTCGGCTTCCCAAAATGCTAGG | GCCCCGATTCATATCTCTAAAGG |
| Strand | - | + |
| Off-target summary | {0: 15, 1: 944, 2: 19012, 3: 167698, 4: 293570} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||