|
Left Crispr |
Right Crispr |
| Crispr ID |
1018883070 |
1018883074 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:167904468-167904490
|
6:167904507-167904529
|
| Sequence |
CCAAAATGCTAGGATTACAGGTG |
GCCCCGATTCATATCTCTAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 385, 1: 11009, 2: 97325, 3: 234439, 4: 289610} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|