ID: 1018908310_1018908322

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1018908310 1018908322
Species Human (GRCh38) Human (GRCh38)
Location 6:168087904-168087926 6:168087938-168087960
Sequence CCCCAGATCACAGATTGAGAACC GAGGGGCGGCATGAGCCAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 13, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!