ID: 1019055765_1019055775

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1019055765 1019055775
Species Human (GRCh38) Human (GRCh38)
Location 6:169222246-169222268 6:169222278-169222300
Sequence CCCGTCCCCGTGGTGGAGTTCAC GGACACGCCGGAGTAGCCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 58} {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!