ID: 1019055769_1019055778

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1019055769 1019055778
Species Human (GRCh38) Human (GRCh38)
Location 6:169222253-169222275 6:169222288-169222310
Sequence CCGTGGTGGAGTTCACCACCTTG GAGTAGCCATAGGCCCGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 138} {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!