ID: 1019055773_1019055777

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1019055773 1019055777
Species Human (GRCh38) Human (GRCh38)
Location 6:169222268-169222290 6:169222287-169222309
Sequence CCACCTTGAGGGACACGCCGGAG GGAGTAGCCATAGGCCCGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51} {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!