ID: 1019058348_1019058357

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1019058348 1019058357
Species Human (GRCh38) Human (GRCh38)
Location 6:169238759-169238781 6:169238797-169238819
Sequence CCACATCAGAGGTAAGGTGCCCT CTGGGGCCACAGGGACATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94} {0: 1, 1: 0, 2: 1, 3: 36, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!