ID: 1019058352_1019058365

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1019058352 1019058365
Species Human (GRCh38) Human (GRCh38)
Location 6:169238779-169238801 6:169238831-169238853
Sequence CCTGAGGATGACACAGCTCTGGG GGATGGTGACTAGTTTAGTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!