ID: 1019340494_1019340503

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1019340494 1019340503
Species Human (GRCh38) Human (GRCh38)
Location 7:506768-506790 7:506790-506812
Sequence CCCGGCCAGTCACTCCCCCAGGG GCTGCCGGTCAGTCACATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 311} {0: 1, 1: 0, 2: 1, 3: 3, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!