ID: 1019340745_1019340749

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1019340745 1019340749
Species Human (GRCh38) Human (GRCh38)
Location 7:507733-507755 7:507746-507768
Sequence CCAAGGCCCACCGAAAGGCAGAA AAAGGCAGAAACTGCGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!