ID: 1019503992_1019503997

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1019503992 1019503997
Species Human (GRCh38) Human (GRCh38)
Location 7:1381399-1381421 7:1381450-1381472
Sequence CCGCAGAGGCGGTGTGATGGCAC GGTGCAAATAATGGTTTAATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 45, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!