ID: 1019664778_1019664788

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1019664778 1019664788
Species Human (GRCh38) Human (GRCh38)
Location 7:2246366-2246388 7:2246403-2246425
Sequence CCAGGAAAATGCTCTGAGGGCCT GAGTGTGGAAGGAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171} {0: 1, 1: 7, 2: 209, 3: 1626, 4: 5490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!