ID: 1019726238_1019726244

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1019726238 1019726244
Species Human (GRCh38) Human (GRCh38)
Location 7:2604318-2604340 7:2604358-2604380
Sequence CCGGGCTGATCTGAATTTCCTGG GCCTCAGCCTCCCAAAGTGCTGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 262, 3: 5366, 4: 43206} {0: 56931, 1: 168651, 2: 218048, 3: 269456, 4: 306914}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!