|
Left Crispr |
Right Crispr |
Crispr ID |
1019726238 |
1019726246 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:2604318-2604340
|
7:2604359-2604381
|
Sequence |
CCGGGCTGATCTGAATTTCCTGG |
CCTCAGCCTCCCAAAGTGCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 5, 2: 262, 3: 5366, 4: 43206} |
{0: 90349, 1: 212695, 2: 235979, 3: 260133, 4: 296590} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|