ID: 1019726238_1019726248

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1019726238 1019726248
Species Human (GRCh38) Human (GRCh38)
Location 7:2604318-2604340 7:2604367-2604389
Sequence CCGGGCTGATCTGAATTTCCTGG TCCCAAAGTGCTGGGATTACAGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 262, 3: 5366, 4: 43206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!