ID: 1019865232_1019865238

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1019865232 1019865238
Species Human (GRCh38) Human (GRCh38)
Location 7:3702503-3702525 7:3702551-3702573
Sequence CCGGATAGCATTCACCACTCTCA GCTTCATTCATACCTGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 108} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!