ID: 1019889244_1019889254

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1019889244 1019889254
Species Human (GRCh38) Human (GRCh38)
Location 7:3932848-3932870 7:3932882-3932904
Sequence CCCCAAAAGAAGCCAACACCCAC CTGTGTGTTCAGATAGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!