ID: 1019889245_1019889254

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1019889245 1019889254
Species Human (GRCh38) Human (GRCh38)
Location 7:3932849-3932871 7:3932882-3932904
Sequence CCCAAAAGAAGCCAACACCCACC CTGTGTGTTCAGATAGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 182} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!