ID: 1019935742_1019935751

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1019935742 1019935751
Species Human (GRCh38) Human (GRCh38)
Location 7:4256312-4256334 7:4256349-4256371
Sequence CCATTCCAGAAATATCCTGGCCT TCTGATATTCAGAGGGGACTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!