ID: 1020192304_1020192317

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1020192304 1020192317
Species Human (GRCh38) Human (GRCh38)
Location 7:6009489-6009511 7:6009534-6009556
Sequence CCACGTGCAGGTAGGAGCGCGGG GCGGCGACCGGCTGCTGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 1, 3: 8, 4: 76} {0: 1, 1: 0, 2: 3, 3: 14, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!