ID: 1020192311_1020192320

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1020192311 1020192320
Species Human (GRCh38) Human (GRCh38)
Location 7:6009516-6009538 7:6009545-6009567
Sequence CCCGCCCAGTGCGCACGCGCGGC CTGCTGGCCCGGGTCCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 3, 3: 13, 4: 105} {0: 1, 1: 1, 2: 0, 3: 32, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!