ID: 1020204558_1020204567

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1020204558 1020204567
Species Human (GRCh38) Human (GRCh38)
Location 7:6104954-6104976 7:6104972-6104994
Sequence CCCCCGCCGGGCGGCTGGGCTGT GCTGTGTGCGGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183} {0: 1, 1: 1, 2: 13, 3: 169, 4: 1049}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!