ID: 1020214260_1020214265

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1020214260 1020214265
Species Human (GRCh38) Human (GRCh38)
Location 7:6177635-6177657 7:6177655-6177677
Sequence CCATGGACACGGGAGAGGAACCG CCGGTTGCACTGGGCTCGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71} {0: 1, 1: 0, 2: 1, 3: 4, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!