ID: 1020430128_1020430134

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1020430128 1020430134
Species Human (GRCh38) Human (GRCh38)
Location 7:8110124-8110146 7:8110159-8110181
Sequence CCCATTTCCCACCATGACTACTA ATCCCCCAAAGTTCATGTGTTGG
Strand - +
Off-target summary No data {0: 9, 1: 107, 2: 311, 3: 522, 4: 757}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!