ID: 1020899828_1020899836

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1020899828 1020899836
Species Human (GRCh38) Human (GRCh38)
Location 7:13990599-13990621 7:13990648-13990670
Sequence CCCAGGGTTGGGGGCGAGCGGTG ACTAGGACGTTAAGCAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 200} {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!