ID: 1020975098_1020975102

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1020975098 1020975102
Species Human (GRCh38) Human (GRCh38)
Location 7:14996233-14996255 7:14996255-14996277
Sequence CCCCACTCAGCTCTTACAGTGGG GCCTTCACCTTAATTAGAGTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!