ID: 1021221943_1021221949

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1021221943 1021221949
Species Human (GRCh38) Human (GRCh38)
Location 7:17984857-17984879 7:17984887-17984909
Sequence CCTCCGGCTCTCGGGCCCAAGCG ACCTCAGCCTCCTGAGTAGCTGG
Strand - +
Off-target summary No data {0: 12610, 1: 113153, 2: 218440, 3: 237917, 4: 144947}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!