ID: 1021221943_1021221951

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1021221943 1021221951
Species Human (GRCh38) Human (GRCh38)
Location 7:17984857-17984879 7:17984888-17984910
Sequence CCTCCGGCTCTCGGGCCCAAGCG CCTCAGCCTCCTGAGTAGCTGGG
Strand - +
Off-target summary No data {0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!