ID: 1021279785_1021279795

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1021279785 1021279795
Species Human (GRCh38) Human (GRCh38)
Location 7:18703753-18703775 7:18703766-18703788
Sequence CCCCCAATCCCCATCCCTGTCCC TCCCTGTCCCCCAGGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 132, 4: 954} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!