ID: 1021493498_1021493505

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1021493498 1021493505
Species Human (GRCh38) Human (GRCh38)
Location 7:21246593-21246615 7:21246609-21246631
Sequence CCAGGCAGAGGCGCTCCTCACTT CTCACTTCCCAGATGGGGTGGGG
Strand - +
Off-target summary {0: 600, 1: 9309, 2: 12337, 3: 4383, 4: 1109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!