ID: 1021496982_1021496986

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1021496982 1021496986
Species Human (GRCh38) Human (GRCh38)
Location 7:21286072-21286094 7:21286115-21286137
Sequence CCCTTGGATGGCAATAATAAAAA CTGTGAGGATGTGAAGAAATTGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 122, 3: 1246, 4: 21634}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!