ID: 1021586722_1021586724

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1021586722 1021586724
Species Human (GRCh38) Human (GRCh38)
Location 7:22216406-22216428 7:22216424-22216446
Sequence CCTAGGAATCACCAGGACTGCAG TGCAGTCATGTATCTTCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 257} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!