|
Left Crispr |
Right Crispr |
| Crispr ID |
1021590464 |
1021590472 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:22255475-22255497
|
7:22255501-22255523
|
| Sequence |
CCCAGTGACTTGGGAGGCTGAGG |
GAGGATCACCTGACTCTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 121, 1: 3448, 2: 105765, 3: 224220, 4: 366136} |
{0: 2, 1: 61, 2: 1312, 3: 8183, 4: 40843} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|